p15A-OptoCre-cat-P-R
(Plasmid #189853)

• Purpose: Cre-inducible activation of cat for chloramphenicol resistance.
• Depositing Lab: Mary Dunlop
• Publication: Sheets et al Nat Commun. 2023 Feb 23;14(1):1034. doi: 10.1038/s41467-023-36670-2.

Backbone

• Vector backbone: pBbA-k
• Backbone size w/o insert (bp): 2297
• Total vector size (bp): 3427
• Vector type: Bacterial Expression, Cre/Lox, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: When transformed with Opto-Cre-Vvd2, store in the dark.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: P-loxP-TT-loxP-R-cat
• Insert Size (bp): 1130
• Promoter: P (T7 phage gene 10)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATCTTCCCCATCGGTGATGTCG
• 3′ sequencing primer: TTTCGCCACCACTGATTTGAGC

Resource Information

• Supplemental Documents:
  • p15A-OptoCre-cat-P-R (seq_URNxDcSL).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.