Skip to main content
Addgene

pGEL639
(Plasmid #189833)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189833 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLGE635
  • Backbone manufacturer
    Shishiliu
  • Backbone size (bp) 15480
  • Modifications to backbone
    add Dnmt3A-Dnmt3L and KRAB domains
  • Vector type
    CRISPR ; T-DNA clone
  • Promoter ZmUbi1
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctttgtgcagagactgatgtggg
  • 3′ sequencing primer ttctaataaacgctcttttctct
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: This plasmid contains an IS4-like element inserted within the backbone. This element is located outside of the LB-TDNA repeat and RB-TDNA repeat regions. This insertion is not expected to impact the plasmid's functionality in plants.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEL639 was a gift from Yong Zhang (Addgene plasmid # 189833 ; http://n2t.net/addgene:189833 ; RRID:Addgene_189833)

  • For your References section:

    Hypercompact CRISPR-Cas12j2 (CasPhi) enables genome editing, gene activation, and epigenome editing in plants. Liu S, Sretenovic S, Fan T, Cheng Y, Li G, Qi A, Tang X, Xu Y, Guo W, Zhong Z, He Y, Liang Y, Han Q, Zheng X, Gu X, Qi Y, Zhang Y. Plant Commun. 2022 Sep 20:100453. doi: 10.1016/j.xplc.2022.100453. 10.1016/j.xplc.2022.100453 PubMed 36127876
Related items: