Skip to main content
Addgene

pGEL637
(Plasmid #189832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189832 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLGE635
  • Backbone manufacturer
    Shishiliu
  • Backbone size (bp) 15480
  • Modifications to backbone
    replace Cas12j2 to nCas12j2
  • Vector type
    CRISPR ; T-DNA clone
  • Promoter ZmUbi1
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctttgtgcagagactgatgtggg
  • 3′ sequencing primer ttctaataaacgctcttttctct
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEL637 was a gift from Yong Zhang (Addgene plasmid # 189832 ; http://n2t.net/addgene:189832 ; RRID:Addgene_189832)
  • For your References section:

    Hypercompact CRISPR-Cas12j2 (CasPhi) enables genome editing, gene activation, and epigenome editing in plants. Liu S, Sretenovic S, Fan T, Cheng Y, Li G, Qi A, Tang X, Xu Y, Guo W, Zhong Z, He Y, Liang Y, Han Q, Zheng X, Gu X, Qi Y, Zhang Y. Plant Commun. 2022 Sep 20:100453. doi: 10.1016/j.xplc.2022.100453. 10.1016/j.xplc.2022.100453 PubMed 36127876