pGEL635
(Plasmid
#189829)
-
Purpose(Empty Backbone) The T-DNA backbone of Cas12j2 for genome editing in rice
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLSS424
-
Backbone manufacturerShishiliu
- Backbone size (bp) 16893
-
Modifications to backboneadd ccdb
-
Vector typeCRISPR ; T-DNA clone
- Promoter ZmUbi1
-
Selectable markersHygromycin
-
Tag
/ Fusion Protein
- ccdb (N terminal on insert)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ctttgtgcagagactgatgtggg
- 3′ sequencing primer ttctaataaacgctcttttctct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEL635 was a gift from Yong Zhang (Addgene plasmid # 189829 ; http://n2t.net/addgene:189829 ; RRID:Addgene_189829) -
For your References section:
Hypercompact CRISPR-Cas12j2 (CasPhi) enables genome editing, gene activation, and epigenome editing in plants. Liu S, Sretenovic S, Fan T, Cheng Y, Li G, Qi A, Tang X, Xu Y, Guo W, Zhong Z, He Y, Liang Y, Han Q, Zheng X, Gu X, Qi Y, Zhang Y. Plant Commun. 2022 Sep 20:100453. doi: 10.1016/j.xplc.2022.100453. 10.1016/j.xplc.2022.100453 PubMed 36127876