pD2529-CAG-aIIb
(Plasmid
#189796)
-
PurposeExpression of full length human integrin aIIb
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepD2529CAG
-
Backbone manufacturerAtum
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameaIIb
-
Alt namealpha II b
-
SpeciesH. sapiens (human)
-
Entrez GeneITGA2B (a.k.a. BDPLT16, BDPLT2, CD41, CD41B, GP2B, GPIIb, GT, GT1, GTA, HPA3, PPP1R93)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAAC
- 3′ sequencing primer AAAGGCTAAGTAACATCTGTGGCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pD2529-CAG-aIIb was a gift from Timothy Springer (Addgene plasmid # 189796 ; http://n2t.net/addgene:189796 ; RRID:Addgene_189796) -
For your References section:
A general chemical principle for creating closure-stabilizing integrin inhibitors. Lin FY, Li J, Xie Y, Zhu J, Huong Nguyen TT, Zhang Y, Zhu J, Springer TA. Cell. 2022 Sep 15;185(19):3533-3550.e27. doi: 10.1016/j.cell.2022.08.008. 10.1016/j.cell.2022.08.008 PubMed 36113427