Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-v2-ALDH1A3gRNA1
(Plasmid #189746)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189746 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti-v2
  • Total vector size (bp) 13014
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9, ALDH1A3 gRNA
  • gRNA/shRNA sequence
    tggaaaacgggcagccggac
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBl (unknown if destroyed)
  • 3′ cloning site BsmBl (unknown if destroyed)
  • 5′ sequencing primer N/A
  • 3′ sequencing primer N/A
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-v2-ALDH1A3gRNA1 was a gift from Robert Sobol (Addgene plasmid # 189746 ; http://n2t.net/addgene:189746 ; RRID:Addgene_189746)
  • For your References section:

    A specific inhibitor of ALDH1A3 regulates retinoic acid biosynthesis in glioma stem cells. Li J, Garavaglia S, Ye Z, Moretti A, Belyaeva OV, Beiser A, Ibrahim M, Wilk A, McClellan S, Klyuyeva AV, Goggans KR, Kedishvili NY, Salter EA, Wierzbicki A, Migaud ME, Mullett SJ, Yates NA, Camacho CJ, Rizzi M, Sobol RW. Commun Biol. 2021 Dec 21;4(1):1420. doi: 10.1038/s42003-021-02949-7. 10.1038/s42003-021-02949-7 PubMed 34934174