AatII-pRPS5A-PTP-3Xflag-16S rRNA Right_G1397N
(Plasmid
#189644)
-
Purpose16S rRNA Right_G1397N
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 189644 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAtC
-
Vector typePlant Expression, TALEN
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTALE and DddAtox
-
SpeciesA. thaliana (mustard weed)
- Promoter RPS5A
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCACCACAGCCATGGATTCACAGCTAGTCTTGTCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AatII-pRPS5A-PTP-3Xflag-16S rRNA Right_G1397N was a gift from Jin-Soo Kim (Addgene plasmid # 189644 ; http://n2t.net/addgene:189644 ; RRID:Addgene_189644) -
For your References section:
Targeted A-to-G base editing of chloroplast DNA in plants. Mok YG, Hong S, Bae SJ, Cho SI, Kim JS. Nat Plants. 2022 Dec 1. doi: 10.1038/s41477-022-01279-8. 10.1038/s41477-022-01279-8 PubMed 36456803