Skip to main content
Addgene

pAAV-hSyn-Gluc-RMA-IRES-EGFP
(Plasmid #189629)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 189629 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4569
  • Total vector size (bp) 7126
  • Vector type
    Mammalian Expression, AAV, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Gaussia luciferase fused to Fc
  • Alt name
    Gluc-mouse IgG1 Fc
  • Alt name
    Gluc-RMA
  • Species
    M. musculus (mouse), Synthetic; Gaussia princeps
  • Promoter hSyn
  • Tags / Fusion Proteins
    • Gluc (N terminal on insert)
    • IgG1 Fc (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    IRES-EGFP
  • Promoter IRES

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtatgggatctgatctggggc
  • 3′ sequencing primer aaatgaaagccatacgggaag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Gluc is derived from AAV-hSyn-GlucM23-iChloC-EYFP (Addgene #114102).
IgG1 is derived from SI4-Jamc.2 (Addgene #28216).
IRES-EGFP is derived from pAAV.CMV.Luc.IRES.EGFP.SV40 (Addgene #105533).

Please visit https://www.biorxiv.org/content/10.1101/2022.07.17.500352v1 for BioRxiv preprint

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-Gluc-RMA-IRES-EGFP was a gift from Jerzy Szablowski (Addgene plasmid # 189629 ; http://n2t.net/addgene:189629 ; RRID:Addgene_189629)
  • For your References section:

    Engineered serum markers for non-invasive monitoring of gene expression in the brain. Lee S, Nouraein S, Kwon JJ, Huang Z, Wojick JA, Xia B, Corder G, Szablowski JO. Nat Biotechnol. 2024 Jan 10. doi: 10.1038/s41587-023-02087-x. 10.1038/s41587-023-02087-x PubMed 38200117