pAAV-TRE-Gluc-RMA-IRES-EGFP
(Plasmid #189628)

• Purpose: Expresses Gluc-RMA and EGFP driven by the Tet Response Element (TRE). Plasmid 2 for recording Fos expression.
• Depositing Lab: Jerzy Szablowski
• Publication: Lee et al Nat Biotechnol. 2024 Jan 10. doi: 10.1038/s41587-023-02087-x.

Backbone

• Vector backbone: pAAV V032
• Backbone size w/o insert (bp): 6038
• Total vector size (bp): 8595
• Vector type: Mammalian Expression, AAV, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Gaussia luciferase fused to Fc
• Alt name: Gluc-mouse IgG1 Fc
• Alt name: Gluc-RMA
• Species: M. musculus (mouse), Synthetic; Gaussia princeps
• Promoter: TRE
• Tags / Fusion Proteins:
  • Gluc (N terminal on insert)
  • IgG1 Fc (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cggccgcatctcgagttta

Gene/Insert 2

• Gene/Insert name: IRES-EGFP
• Promoter: IRES

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtatgggatctgatctggggc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

TRE backbone is derived from pAAV-RAM-d2TTA::TRE-MCS-WPRE-pA (Addgene #63931).
Gluc is derived from AAV-hSyn-GlucM23-iChloC-EYFP (Addgene #114102).
IgG1 is derived from SI4-Jamc.2 (Addgene #28216).
IRES-EGFP is derived from pAAV.CMV.Luc.IRES.EGFP.SV40 (Addgene #105533).

Please visit https://www.biorxiv.org/content/10.1101/2022.07.17.500352v1 for BioRxiv preprint