pCAGGS-PSD95-GCaMP2
(Plasmid #18931)

• Depositing Lab: Karel Svoboda
• Publication: Mao et al PLoS ONE. 2008 . 3(3):e1796.

Backbone

• Vector backbone: pCAGGS
• Backbone size w/o insert (bp): 5900
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PSD95-GCaMP2
• Alt name: PSD95
• Species: R. norvegicus (rat)
• Insert Size (bp): 3540
• Entrez Gene: Dlg4 (a.k.a. Dlgh4, PSD95, Sap90)
• Tag / Fusion Protein:
  • His (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: ggttcggcttctggcgtgtgacc
• 3′ sequencing primer: TCC TTA AAC CTG TCT TGT AA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Synthetic construct fused with rat PSD95.