AAV-FLEX-rev-ChR2-tdtomato
(Plasmid #18917)

• Purpose: Cre-dependent viral expression of ChR2-tdTomato for neuronal excitation
• Depositing Lab: Scott Sternson
• Publication: Atasoy et al J Neurosci. 2008 Jul 9. 28(28):7025-30.

Backbone

• Vector backbone: AAV2
• Backbone size w/o insert (bp): 5340
• Vector type: AAV, Cre/Lox ; Adeno-Associated Virus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): Stbl3
• Growth instructions: Stbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Channelrhodopsin 2-tdtomato
• Alt name: ChR2
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 2367
• Promoter: CAG
• Tag / Fusion Protein:
  • tdtomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Spe1 (destroyed during cloning)
• 3′ cloning site: Spe1 (destroyed during cloning)
• 5′ sequencing primer: CTGTGGCTGCGTGAAAGCCTTG

Resource Information

• Supplemental Documents:
  • SmaI digest
• Addgene Notes:
  • Addgene diagnostic digest 3
  • Digest of 18917 with PvuII, Sma1, and SnaB1
  • Addgene Diagnostic Digest
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Karel Svoboda, Janelia Farm Research Campus
• Articles Citing this Plasmid:
  • 45 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in Stbl2 cells from Invitrogen. Also, to minimize recombination, cells should be cultured at 30 C.

Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.

Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence. Please see Reviews in the right column for an image of Addgene's digest with these enzymes.