pCDH-CIBN-CAAX
(Plasmid #188989)

• Purpose: A lentiviral plasmid encoding plasma membrane-tagged CIBN
• Depositing Lab: Jeremy Baskin
• Publication: Tei et al Nat Chem. 2023 May 22. doi: 10.1038/s41557-023-01214-0.

Backbone

• Vector backbone: pCDH-CMV-MCS-EF1-Puro
• Backbone size w/o insert (bp): 7368
• Total vector size (bp): 7965
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CIBN
• Alt name: CIB1
• Species: A. thaliana (mustard weed)
• Insert Size (bp): 513
• Entrez Gene: CIB1 (a.k.a. AT4G34530, T4L20.110, T4L20_110, cryptochrome-interacting basic-helix-loop-helix 1)
• Promoter: CMV
• Tag / Fusion Protein:
  • CAAX (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: N/A
• 3′ sequencing primer: Puro-AS (CGACATCACTTTCCCAGTTTAC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry