pCDH-CRY2-mCh-superPLDx10
(Plasmid #188986)

• Purpose: A lentiviral plasmid encoding CRY2-mCh-superPLDx10 (an engineered PLD mutant with 10 times higher activity than the wild-type)
• Depositing Lab: Jeremy Baskin
• Publication: Tei et al Nat Chem. 2023 May 22. doi: 10.1038/s41557-023-01214-0.

Backbone

• Vector backbone: pCDH-CMV-MCS-EF1-Puro
• Backbone size w/o insert (bp): 7368
• Total vector size (bp): 11167
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PLD
• Alt name: Phospholipase D
• Species: Streptomyces PMF
• Insert Size (bp): 1527
• Mutation: F163L, K249R, G328S, G381V, G429D, D480G
• Promoter: CMV
• Tags / Fusion Proteins:
  • CRY2 (N terminal on insert)
  • mCherry (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: mCh-S (CGTGGAACAGTACGAACGC)
• 3′ sequencing primer: Puro-AS (CGACATCACTTTCCCAGTTTAC)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry