pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g2_CASH-1
(Plasmid
#188976)
-
PurposeA human codon-optimized SpCas9 nickase and chimeric g2 guide RNA expression plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC ori vector
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameg2 guide RNA
-
gRNA/shRNA sequenceCACCGTCCTAAGACCACCCTGAGC
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g2_CASH-1 was a gift from Sangdun Choi (Addgene plasmid # 188976 ; http://n2t.net/addgene:188976 ; RRID:Addgene_188976) -
For your References section:
An Alternate Approach to Generate Induced Pluripotent Stem Cells with Precise CRISPR/Cas9 Tool. Javaid N, Choi S. Stem Cells Int. 2022 Sep 22;2022:4537335. doi: 10.1155/2022/4537335. eCollection 2022. 10.1155/2022/4537335 PubMed 36187228