Skip to main content
Addgene

pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g2_CASH-1
(Plasmid #188976)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188976 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC ori vector
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    g2 guide RNA
  • gRNA/shRNA sequence
    CACCGTCCTAAGACCACCCTGAGC
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g2_CASH-1 was a gift from Sangdun Choi (Addgene plasmid # 188976 ; http://n2t.net/addgene:188976 ; RRID:Addgene_188976)
  • For your References section:

    An Alternate Approach to Generate Induced Pluripotent Stem Cells with Precise CRISPR/Cas9 Tool. Javaid N, Choi S. Stem Cells Int. 2022 Sep 22;2022:4537335. doi: 10.1155/2022/4537335. eCollection 2022. 10.1155/2022/4537335 PubMed 36187228