Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pA-RFP-rG2
(Plasmid #188969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188969 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACBB-eGFP
  • Backbone manufacturer
    Claudia Schmidt-dannert
  • Backbone size w/o insert (bp) 2867
  • Total vector size (bp) 4574
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    1707
  • Promoter Ptrc

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agccagttacctcggttcaa
  • 3′ sequencing primer aacgacaggagcacgatcat
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    sgRNA: agtccatgtaatcagcgtctactagt

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pA-RFP-rG2 was a gift from Seung-Goo Lee (Addgene plasmid # 188969 ; http://n2t.net/addgene:188969 ; RRID:Addgene_188969)
  • For your References section:

    CRISPRi-based programmable logic inverter cascade for antibiotic-free selection and maintenance of multiple plasmids. Kim SK, Kim H, Woo SG, Kim TH, Rha E, Kwon KK, Lee H, Lee SG, Lee DH. Nucleic Acids Res. 2022 Dec 9;50(22):13155-13171. doi: 10.1093/nar/gkac1104. 10.1093/nar/gkac1104 PubMed 36511859