pBAD-HisD-miniGFP1
(Plasmid
#188896)
-
PurposeExpress 6xHis-Tag miniGFP1 in E.coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBAD
- Backbone size w/o insert (bp) 4002
- Total vector size (bp) 4332
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsArabinose administration for protein expression
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameminiGFP1
-
SpeciesSynthetic
-
Insert Size (bp)330
- Promoter araBAD
-
Tag
/ Fusion Protein
- 6xHis (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-HisD-miniGFP1 was a gift from Kiryl Piatkevich (Addgene plasmid # 188896 ; http://n2t.net/addgene:188896 ; RRID:Addgene_188896) -
For your References section:
Enhanced small green fluorescent proteins as a multisensing platform for biosensor development. Liang GT, Lai C, Yue Z, Zhang H, Li D, Chen Z, Lu X, Tao L, Subach FV, Piatkevich KD. Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022. 10.3389/fbioe.2022.1039317 PubMed 36324888