pBAD-HisD-miniGFP1
(Plasmid #188896)

• Purpose: Express 6xHis-Tag miniGFP1 in E.coli
• Depositing Lab: Kiryl Piatkevich
• Publication: Liang et al Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022.

Backbone

• Vector backbone: pBAD
• Backbone size w/o insert (bp): 4002
• Total vector size (bp): 4332
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Arabinose administration for protein expression
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: miniGFP1
• Species: Synthetic
• Insert Size (bp): 330
• Promoter: araBAD
• Tag / Fusion Protein:
  • 6xHis (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ATGCCATAGCATTTTTATCC
• 3′ sequencing primer: GATTTAATCTGTATCAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry