pUC19-Hph
(Plasmid
#188741)
-
PurposepUC19 plasmid (MCS intact) with Hygromycin selection marker
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188741 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2682
- Total vector size (bp) 5380
-
Vector typeFilamentous fungal expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHygromycin
-
Alt nameHygR
-
Alt nameHph
-
Insert Size (bp)2698
- Promoter gpdA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gatgtaacccactcgtgcac
- 3′ sequencing primer caggaaacagctatgaccatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-Hph was a gift from Michael Bromley (Addgene plasmid # 188741 ; http://n2t.net/addgene:188741 ; RRID:Addgene_188741) -
For your References section:
Shining a light on the impact of antifungals on Aspergillus fumigatus subcellular dynamics through fluorescence imaging. Storer ISR, Sastre-Velasquez LE, Easter T, Mertens B, Dallemulle A, Bottery M, Tank R, Offterdinger M, Bromley MJ, van Rhijn N, Gsaller F. Antimicrob Agents Chemother. 2024 Nov 6;68(11):e0080324. doi: 10.1128/aac.00803-24. Epub 2024 Oct 15. 10.1128/aac.00803-24 PubMed 39404344