Skip to main content
Addgene

pIN1 (gpdA-cTerm-mGL-ptrA)
(Plasmid #188735)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188735 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2395
  • Total vector size (bp) 6484
  • Vector type
    Filamentous Fungal expression
  • Selectable markers
    Pyrithiamine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gdpA-mGreenlantern PtrA
  • Species
    Aspergillus fumigatus
  • Insert Size (bp)
    4100
  • Promoter gpdA
  • Tag / Fusion Protein
    • mGreenlantern (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agcgagtcagtgagcgag
  • 3′ sequencing primer tacaatctgctctgatgccg
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIN1 (gpdA-cTerm-mGL-ptrA) was a gift from Michael Bromley (Addgene plasmid # 188735 ; http://n2t.net/addgene:188735 ; RRID:Addgene_188735)

  • For your References section:

    Shining a light on the impact of antifungals on Aspergillus fumigatus subcellular dynamics through fluorescence imaging. Storer ISR, Sastre-Velasquez LE, Easter T, Mertens B, Dallemulle A, Bottery M, Tank R, Offterdinger M, Bromley MJ, van Rhijn N, Gsaller F. Antimicrob Agents Chemother. 2024 Nov 6;68(11):e0080324. doi: 10.1128/aac.00803-24. Epub 2024 Oct 15. 10.1128/aac.00803-24 PubMed 39404344
Related items: