pAAV-CAG-miniGFP1-P2A-FusionRed
(Plasmid #188732)

• Purpose: Express miniGFP1 and FusionRed in mammalian cells
• Depositing Lab: Kiryl Piatkevich
• Publication: Liang et al Front Bioeng Biotechnol. 2022 Oct 17;10:1039317. doi: 10.3389/fbioe.2022.1039317. eCollection 2022.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 4717
• Total vector size (bp): 5845
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: miniGFP1
• Species: Synthetic
• Insert Size (bp): 330
• Promoter: CAG
• Tag / Fusion Protein:
  • FusionRed

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid available for mammalian cell lines only.