RapR-Shp2-mVenus-flag
(Plasmid
#188655)
-
PurposeRapamycin regulated Shp2 phosphatase with mVenus and flag tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188655 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5788
- Total vector size (bp) 8597
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameShp2
-
Alt namePTPN11
-
MutationiFKBP insertion at V406 with deletion of residues 405-407
- Promoter CMV
-
Tags
/ Fusion Proteins
- mVenus (C terminal on insert)
- Flag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RapR-Shp2-mVenus-flag was a gift from Andrei Karginov (Addgene plasmid # 188655 ; http://n2t.net/addgene:188655 ; RRID:Addgene_188655) -
For your References section:
Dissecting protein tyrosine phosphatase signaling by engineered chemogenetic control of its activity. Fauser J, Huyot V, Matsche J, Szynal BN, Alexeev Y, Kota P, Karginov AV. J Cell Biol. 2022 Aug 1;221(8). pii: 213352. doi: 10.1083/jcb.202111066. Epub 2022 Jul 13. 10.1083/jcb.202111066 PubMed 35829702