Skip to main content
Addgene

AAV_A2S-8
(Plasmid #188654)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188654 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    AID2S--nSaCas9-UGI
  • Species
    Synthetic; Staphylococcus aureus
  • Insert Size (bp)
    5175
  • Mutation
    D10A for SaCas9
  • GenBank ID
  • Promoter Scp1
  • Tag / Fusion Protein
    • UGI

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtacttatataagggggtgg
  • 3′ sequencing primer cacacaaaaaaccaacacac
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Sa-sgRNA
  • Species
    Staphylococcus aureus
  • Promoter U6

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cagcctcgaaataaaagatc
  • 3′ sequencing primer gagggcctatttcccatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV_A2S-8 was a gift from Keiji Nishida (Addgene plasmid # 188654 ; http://n2t.net/addgene:188654 ; RRID:Addgene_188654)
  • For your References section:

    Cytosine base editing systems with minimized off-target effect and molecular size. Li A, Mitsunobu H, Yoshioka S, Suzuki T, Kondo A, Nishida K. Nat Commun. 2022 Aug 8;13(1):4531. doi: 10.1038/s41467-022-32157-8. 10.1038/s41467-022-32157-8 PubMed 35941130