Skip to main content
Addgene

lenti-ATAD2-plx303
(Plasmid #188635)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188635 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    plx303
  • Backbone manufacturer
    Addgene Plasmid# 25897
  • Backbone size w/o insert (bp) 7715
  • Total vector size (bp) 11889
  • Vector type
    Mammalian Expression, Bacterial Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATAD2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4174
  • Entrez Gene
    ATAD2 (a.k.a. ANCCA, CT137, PRO2000)
  • Promoter CMV

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer caccatggtggttctccgcagcag
  • 3′ sequencing primer TTatctggaacaactgaagttt
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene Plasmid# 65370

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti-ATAD2-plx303 was a gift from Lorenz Studer (Addgene plasmid # 188635 ; http://n2t.net/addgene:188635 ; RRID:Addgene_188635)

  • For your References section:

    Developmental chromatin programs determine oncogenic competence in melanoma. Baggiolini A, Callahan SJ, Montal E, Weiss JM, Trieu T, Tagore MM, Tischfield SE, Walsh RM, Suresh S, Fan Y, Campbell NR, Perlee SC, Saurat N, Hunter MV, Simon-Vermot T, Huang TH, Ma Y, Hollmann T, Tickoo SK, Taylor BS, Khurana E, Koche RP, Studer L, White RM. Science. 2021 Sep 3;373(6559):eabc1048. doi: 10.1126/science.abc1048. Epub 2021 Sep 3. 10.1126/science.abc1048 PubMed 34516843
Related items:
Commonly requested with: