Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUC19 EGFRup-CD3ε-mNeonGreen-EGFRdown
(Plasmid #188634)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188634 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Total vector size (bp) 4861
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFR
  • Alt name
    ERBB
  • Species
    H. sapiens (human), Synthetic
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
  • Tag / Fusion Protein
    • CD3ε-mNeonGreen (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer agctggcacgacaggtttcccgactggaaagc
  • 3′ sequencing primer tcgcgcgtttcggtgatgacgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.13.503850 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUC19 EGFRup-CD3ε-mNeonGreen-EGFRdown was a gift from Jared Toettcher (Addgene plasmid # 188634 ; http://n2t.net/addgene:188634 ; RRID:Addgene_188634)
  • For your References section:

    pYtags enable spatiotemporal measurements of receptor tyrosine kinase signaling in living cells. Farahani PE, Yang X, Mesev EV, Fomby KA, Brumbaugh-Reed EH, Bashor CJ, Nelson CM, Toettcher JE. Elife. 2023 May 22;12:e82863. doi: 10.7554/eLife.82863. 10.7554/eLife.82863 PubMed 37212240