Tet-off TauRD (P301L/V337M)
(Plasmid
#188572)
-
PurposeDox-repressible expression of the Tau repeat domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCW57.1-MAT2A (Addgene Plasmid #100521)
- Total vector size (bp) 7920
-
Modifications to backbonepCW57.1-MAT2A plasmid was modified: MAT2A was replaced by TauRD and myc tag.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTau repeat domain
-
Alt nameTauRD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)390
-
MutationP301L and V337M
-
Entrez GeneMAPT (a.k.a. DDPAC, FTD1, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
- Promoter pTight TRE
-
Tag
/ Fusion Protein
- Myc (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAAGCAGAGCTCGTTTAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tet-off TauRD (P301L/V337M) was a gift from Franz-Ulrich Hartl (Addgene plasmid # 188572 ; http://n2t.net/addgene:188572 ; RRID:Addgene_188572) -
For your References section:
The AAA+ chaperone VCP disaggregates Tau fibrils and generates aggregate seeds in a cellular system. Saha I, Yuste-Checa P, Da Silva Padilha M, Guo Q, Korner R, Holthusen H, Trinkaus VA, Dudanova I, Fernandez-Busnadiego R, Baumeister W, Sanders DW, Gautam S, Diamond MI, Hartl FU, Hipp MS. Nat Commun. 2023 Feb 2;14(1):560. doi: 10.1038/s41467-023-36058-2. 10.1038/s41467-023-36058-2 PubMed 36732333