HT7-mTurquoise2-KDEL
(Plasmid
#188571)
-
PurposeExpresses fluorescent HaloTag7-mTurquoise2 fusion protein in mammalian cells with localization in the endoplasmic reticulum.
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188571 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4811
- Total vector size (bp) 5696
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag7
-
SpeciesSynthetic
-
Insert Size (bp)885
-
GenBank IDN/A
- Promoter CMV
-
Tags
/ Fusion Proteins
- mTurquoise2 (C terminal on backbone)
- KDEL (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byHaloTag7 from Okada lab (addgene #64691) mTurquoise2-KDEL from Gadella lab (addgene #36204)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HT7-mTurquoise2-KDEL was a gift from Pablo Rivera-Fuentes (Addgene plasmid # 188571 ; http://n2t.net/addgene:188571 ; RRID:Addgene_188571)
Map uploaded by the depositor.
