Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

AAV2-hSyn-G-Flamp1-mut
(Plasmid #188570)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188570 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-hSyn
  • Backbone size w/o insert (bp) 4495
  • Total vector size (bp) 5761
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    G-Flamp1-mut
  • Species
    Synthetic
  • Insert Size (bp)
    1266
  • Promoter hSyn
  • Tag / Fusion Protein
    • His tag

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer AGCCGGACCGCACCACGCGAGGCG
  • 3′ sequencing primer CATTAAAGCAGCGTATCCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV2-hSyn-G-Flamp1-mut was a gift from Jun Chu (Addgene plasmid # 188570 ; http://n2t.net/addgene:188570 ; RRID:Addgene_188570)
  • For your References section:

    A high-performance genetically encoded fluorescent indicator for in vivo cAMP imaging. Wang L, Wu C, Peng W, Zhou Z, Zeng J, Li X, Yang Y, Yu S, Zou Y, Huang M, Liu C, Chen Y, Li Y, Ti P, Liu W, Gao Y, Zheng W, Zhong H, Gao S, Lu Z, Ren PG, Ng HL, He J, Chen S, Xu M, Li Y, Chu J. Nat Commun. 2022 Sep 12;13(1):5363. doi: 10.1038/s41467-022-32994-7. 10.1038/s41467-022-32994-7 PubMed 36097007