pX330-U6-L101_guide-CBh-hSpCas9
(Plasmid
#188547)
-
PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid L101
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSPCas9(BB)-2A-GFP
- Backbone size w/o insert (bp) 8467
- Total vector size (bp) 8487
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA
-
gRNA/shRNA sequenceCGTCACTGAGACAGTGCGCA GGG
-
SpeciesH. sapiens (human)
- Promoter U6
-
Tag
/ Fusion Protein
- T2A-EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer n/a
- 3′ sequencing primer n/a (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-U6-L101_guide-CBh-hSpCas9 was a gift from Darrell Kotton (Addgene plasmid # 188547 ; http://n2t.net/addgene:188547 ; RRID:Addgene_188547) -
For your References section:
Human pluripotent stem cell modeling of alveolar type 2 cell dysfunction caused by ABCA3 mutations. Sun YL, Hennessey EE, Heins H, Yang P, Villacorta-Martin C, Kwan J, Gopalan K, James M, Emili A, Cole FS, Wambach JA, Kotton DN. J Clin Invest. 2024 Jan 16;134(2):e164274. doi: 10.1172/JCI164274. 10.1172/JCI164274 PubMed 38226623