Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOttc1501 - pscAAV CMV-IE hCDNF
(Plasmid #188538)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188538 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Pottc1491 - pscAAV CMV-IE iRFP-FLAG
  • Backbone manufacturer
    NIDA GEVVC
  • Backbone size w/o insert (bp) 3747
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hCDNF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    564
  • Entrez Gene
    CDNF (a.k.a. ARMETL1)
  • Promoter CMV-IE

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CMV-Forward CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer bGHpA R30 GGCTGGCAACTAGAAGGCAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    NIDA GEVVC

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOttc1501 - pscAAV CMV-IE hCDNF was a gift from Brandon Harvey (Addgene plasmid # 188538 ; http://n2t.net/addgene:188538 ; RRID:Addgene_188538)