rtTA-sg-mGreenLantern332
(Plasmid #188483)

• Purpose: gRNA plasmid with neomycin resistance expressing a single guide RNA targeting mGreenLantern fluorescent protein site 332.
• Depositing Labs: Indeever Madireddy, Johan Sosa
• Publication: Madireddy et al MicroPubl Biol. 2022 Jun 16;2022. doi: 10.17912/micropub.biology.000590. eCollection 2022.

Backbone

• Vector backbone: PB_rtTA_BsmBI
• Backbone manufacturer: System Biosciences
• Backbone size w/o insert (bp): 8652
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mGreenLantern sgRNA
• Alt name: monomeric green lantern single guide RNA
• gRNA/shRNA sequence: tacctacaagacccgcgccg
• Species: Synthetic
• Insert Size (bp): 21
• Mutation: None
• Promoter: U6
• Tag / Fusion Protein:
  • PB_rtTA_BsmBI (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: GAG GGC CTA TTT CCC ATG ATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was cloned with the one step BsmBI restriction enzyme cloning method. Please note that gRNA sequences that do not start with a G, need a G added to the sequence before cloning for U6 promoter transcription.