MG1655-OptoCre-knt-P-R*
(Bacterial strain
#188478)
-
PurposeCre-inducible activation of knt for kanamycin resistance.
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 188478 | Bacteria in agar stab | 1 | $85 |
Backbone
-
Vector backboneE. coli K-12 MG1655
-
Modifications to backboneCloning Method: Lambda Red (Datsenko-Wanner)
Growth in Bacteria
-
Bacterial Resistance(s)None
-
Growth Temperature37°C
-
Growth Strain(s)This is a strain.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameP-R*-lox-TT-lox-knt
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACTAACGGCTTCGGCTGTATC
- 3′ sequencing primer GTGAAACGGTTGTACGGTTATGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.06.10.495621v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MG1655-OptoCre-knt-P-R* was a gift from Mary Dunlop (Addgene plasmid # 188478) -
For your References section:
An optogenetic toolkit for light-inducible antibiotic resistance. Sheets MB, Tague N, Dunlop MJ. Nat Commun. 2023 Feb 23;14(1):1034. doi: 10.1038/s41467-023-36670-2. 10.1038/s41467-023-36670-2 PubMed 36823420