Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKDR-Lenti-CBh.6-SOD1
(Plasmid #188460)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188460 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKDR-Lenti-TetOn
  • Total vector size (bp) 8884
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SOD1
  • Species
    H. sapiens (human)
  • Entrez Gene
    SOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
  • Promoter CBh

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atggcgacgaaggccgtgtg
  • 3′ sequencing primer ttgggcgatcccaattacacc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKDR-Lenti-CBh.6-SOD1 was a gift from Erik Dent (Addgene plasmid # 188460 ; http://n2t.net/addgene:188460 ; RRID:Addgene_188460)
  • For your References section:

    A Single Transcript Knockdown-Replacement Strategy Employing 5' UTR Secondary Structures to Precisely Titrate Rescue Protein Translation. Millette MM, Holland ED, Tenpas TJ, Dent EW. Front Genome Ed. 2022 Mar 28;4:803375. doi: 10.3389/fgeed.2022.803375. eCollection 2022. 10.3389/fgeed.2022.803375 PubMed 35419562