pKDR-Lenti-CBh.6-SOD1
(Plasmid
#188460)
-
PurposeFor knockdown-replacement of SOD1 gene (SOD1 KDR lentiviral transfer plasmid, Fig 4)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188460 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKDR-Lenti-TetOn
- Total vector size (bp) 8884
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOD1
-
SpeciesH. sapiens (human)
-
Entrez GeneSOD1 (a.k.a. ALS, ALS1, HEL-S-44, IPOA, SOD, STAHP, hSod1, homodimer)
- Promoter CBh
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atggcgacgaaggccgtgtg
- 3′ sequencing primer ttgggcgatcccaattacacc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKDR-Lenti-CBh.6-SOD1 was a gift from Erik Dent (Addgene plasmid # 188460 ; http://n2t.net/addgene:188460 ; RRID:Addgene_188460) -
For your References section:
A Single Transcript Knockdown-Replacement Strategy Employing 5' UTR Secondary Structures to Precisely Titrate Rescue Protein Translation. Millette MM, Holland ED, Tenpas TJ, Dent EW. Front Genome Ed. 2022 Mar 28;4:803375. doi: 10.3389/fgeed.2022.803375. eCollection 2022. 10.3389/fgeed.2022.803375 PubMed 35419562