K365-micro
(Plasmid #188457)

• Purpose: Component of optically-induced motor dimerization system
• Depositing Lab: Zvonimir Dogic
• Publication: Lemma et al PNAS Nexus. 2023 Apr 12;2(5):pgad130. doi: 10.1093/pnasnexus/pgad130. eCollection 2023 May.

Backbone

• Vector backbone: pQE-80L
• Backbone manufacturer: Qiagen
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Kinesin 1-365
• Alt name: Kinesin heavy chain
• Alt name: His MBP K365 SspB micro
• Species: D. melanogaster (fly)
• Mutation: Kinesin amino acids 1-365
• Entrez Gene: Khc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
• Promoter: T7
• Tags / Fusion Proteins:
  • 6xHis-MBP-TEV (N terminal on insert)
  • SspB micro (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAACGCCCGACTAAAGGGTAAGggtagtggtagtggatccagctccccgaaacgc
• 3′ sequencing primer: CTTACCCTTTAGTCGGGCGTTC

Resource Information

• Supplemental Documents:
  • mbp-k365-gs2-micro.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid was derived from plasmids made by Jeff Gelles, Brian Kulman and Matt Thomson. This plasmid was created with Tyler Ross and Matt Thomson.