Skip to main content
Addgene

K365-micro
(Plasmid #188457)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188457 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pQE-80L
  • Backbone manufacturer
    Qiagen
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Kinesin 1-365
  • Alt name
    Kinesin heavy chain
  • Alt name
    His MBP K365 SspB micro
  • Species
    D. melanogaster (fly)
  • Mutation
    Kinesin amino acids 1-365
  • Entrez Gene
    Khc (a.k.a. Dmel_CG7765, 2R6, CG7765, DK, DKH, Dm KHC, DmK, DmKHC, Dmel\CG7765, Dmkin, KHC, KIF 5A, KIF5, KIF5B, KIN, Kif5, Kin, Kin-1, Kinesin, Kinesin-1, khc, kin, kinesin, kinesin-1, l(2)W12, l(2)k13219, l(2)k13314, l(2R)W12, pgs)
  • Promoter T7
  • Tags / Fusion Proteins
    • 6xHis-MBP-TEV (N terminal on insert)
    • SspB micro (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAACGCCCGACTAAAGGGTAAGggtagtggtagtggatccagctccccgaaacgc
  • 3′ sequencing primer CTTACCCTTTAGTCGGGCGTTC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid was derived from plasmids made by Jeff Gelles, Brian Kulman and Matt Thomson. This plasmid was created with Tyler Ross and Matt Thomson.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K365-micro was a gift from Zvonimir Dogic (Addgene plasmid # 188457 ; http://n2t.net/addgene:188457 ; RRID:Addgene_188457)

  • For your References section:

    Spatio-temporal patterning of extensile active stresses in microtubule-based active fluids. Lemma LM, Varghese M, Ross TD, Thomson M, Baskaran A, Dogic Z. PNAS Nexus. 2023 Apr 12;2(5):pgad130. doi: 10.1093/pnasnexus/pgad130. eCollection 2023 May. 10.1093/pnasnexus/pgad130 PubMed 37168671
Related items: