pGP4G-REL2N91-ccdB
(Plasmid
#188444)
-
PurposeZea Mays Nuclear Auxin Signaling CoRepressor REL2N91 and pDEST
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGP4G
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameREL2N91/ccdB
-
SpeciesSynthetic
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAAATTAAAGCCTTCGAGCGTCCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGP4G-REL2N91-ccdB was a gift from Britney Moss (Addgene plasmid # 188444 ; http://n2t.net/addgene:188444 ; RRID:Addgene_188444) -
For your References section:
A Synthetic Approach Allows Rapid Characterization of the Maize Nuclear Auxin Response Circuit. Ramos Baez R, Buckley Y, Yu H, Chen Z, Gallavotti A, Nemhauser JL, Moss BL. Plant Physiol. 2020 Apr;182(4):1713-1722. doi: 10.1104/pp.19.01475. Epub 2020 Mar 2. 10.1104/pp.19.01475 PubMed 32123041