p426-Cup1p-FUS-FusionRed
(Plasmid #188393)

• Purpose: Cu2+-dependent expression of N-terminal FUS fused with red fluorescent protein in yeast cells
• Depositing Lab: Michihiko Kataoka
• Publication: Utsumi et al PLoS One. 2023 Apr 13;18(4):e0283002. doi: 10.1371/journal.pone.0283002. eCollection 2023.

Backbone

• Vector backbone: 426Gal-FUS-YFP (addgene #29592)
• Backbone manufacturer: Aaron Gitler
• Backbone size w/o insert (bp): 6185
• Total vector size (bp): 8522
• Vector type: Yeast Expression
• Selectable markers: URA3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FUS
• Alt name: N-terminal region of human fused in sarcoma (FUS)
• Species: H. sapiens (human)
• Insert Size (bp): 2337
• Entrez Gene: FUS (a.k.a. ALS6, ETM4, FUS1, HNRNPP2, POMP75, TLS, altFUS)
• Promoter: CUP1 promoter
• Tag / Fusion Protein:
  • FusionRed

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: Xho1 (not destroyed)
• 5′ sequencing primer: CAGGAAACAGCTATGAC
• 3′ sequencing primer: GACCTAGACTTCAGGTTGTCTAACTCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: FUS-FusionRed-PixD was a gift from Jared Toettcher (Addgene plasmid # 111503 ; http://n2t.net/addgene:111503 ; RRID:Addgene_111503)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry