pc-GAKIN-Ha
(Plasmid
#188246)
-
PurposeExpress GAKIN in mammalian cells with Ha tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188246 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 10944
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGAKIN
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5266
-
Entrez GeneKIF13B (a.k.a. GAKIN)
-
Tag
/ Fusion Protein
- Ha (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CATAGACCCATGAGCTCGCCGGCGGACGAC
- 3′ sequencing primer AACCGGAAATCCTGGGCCAGCCGGCCGCCTG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGakin from Kazusa DNA Research Institute in pBluescript II SK9(+) vector.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pc-GAKIN-Ha was a gift from Joel Pomerantz (Addgene plasmid # 188246 ; http://n2t.net/addgene:188246 ; RRID:Addgene_188246) -
For your References section:
The dynamic distribution of CARD11 at the immunological synapse is regulated by the inhibitory kinesin GAKIN. Lamason RL, Kupfer A, Pomerantz JL. Mol Cell. 2010 Dec 10;40(5):798-809. doi: 10.1016/j.molcel.2010.11.007. 10.1016/j.molcel.2010.11.007 PubMed 21145487