Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW57-Cx26G45E-IRES-GCaMP6s
(Plasmid #188237)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188237 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcW57.1
  • Backbone manufacturer
    Addgene, plasmid 41393
  • Backbone size w/o insert (bp) 7611
  • Total vector size (bp) 9345
  • Modifications to backbone
    1743 bp removed (from 267 to 2009)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GJB2
  • Alt name
    Cx26
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    681
  • Mutation
    p.G45E
  • GenBank ID
    NM_004004.6
  • Entrez Gene
    GJB2 (a.k.a. BAPS, CX26, DFNA3, DFNA3A, DFNB1, DFNB1A, HID, KID, NSRD1, PPK)
  • Promoter Tight TRE promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer ATCGAAGGCTCCCTGTGGTG
  • 3′ sequencing primer ACAGTGTTGGGACAAGGCCA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Cx26 p.G45E was gene-synthesised by Bio-Fab Research, https://www.biofabresearch.com/en/

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-Cx26G45E-IRES-GCaMP6s was a gift from Fabio Mammano (Addgene plasmid # 188237 ; http://n2t.net/addgene:188237 ; RRID:Addgene_188237)
  • For your References section:

    A Quantitative Assay for Ca(2+) Uptake through Normal and Pathological Hemichannels. Nardin C, Tettey-Matey A, Donati V, Marazziti D, Di Pietro C, Peres C, Raspa M, Zonta F, Yang G, Gorelik M, Singh S, Cardarelli L, Sidhu SS, Mammano F. Int J Mol Sci. 2022 Jun 30;23(13). pii: ijms23137337. doi: 10.3390/ijms23137337. 10.3390/ijms23137337 PubMed 35806342