Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMXS-IRES-BLAST flag-CAD 3R-3E
(Plasmid #188148)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 188148 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMXS-IRES-BLAST
  • Backbone size w/o insert (bp) 5623
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAD
  • Alt name
    carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6702
  • Mutation
    TCC -> AGT silent mutations at nt439-441 eliminating PAM site for sgRNA target sequence 5'-ATTGGGGTCCAAGAATGGCA-3' and CGT/CGGCGT -> GAG/GAAGAG mutations at nt6114-6116/6129-6134 for Arg1389/Arg1403/Arg1404 -> Glu mutations of CAD
  • Entrez Gene
    CAD (a.k.a. CDG1Z, DEE50, EIEE50, GATD4)
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
  • 3′ sequencing primer CGGAATTTACGTAGCGGCCGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXS-IRES-BLAST flag-CAD 3R-3E was a gift from Richard Possemato (Addgene plasmid # 188148 ; http://n2t.net/addgene:188148 ; RRID:Addgene_188148)
  • For your References section:

    Allosteric regulation of CAD modulates de novo pyrimidine synthesis during the cell cycle. Shin J, Mir H, Khurram MA, Fujihara KM, Dynlacht BD, Cardozo TJ, Possemato R. Nat Metab. 2023 Feb 6. doi: 10.1038/s42255-023-00735-9. 10.1038/s42255-023-00735-9 PubMed 36747088