Skip to main content
Addgene

pMXS-IRES-BLAST flag-CAD E1367A E1368A E1373A
(Plasmid #188144)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 188144 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pMXS-IRES-BLAST
  • Backbone size w/o insert (bp) 5623
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CAD
  • Alt name
    carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    6702
  • Mutation
    TCC -> AGT silent mutations at nt439-441 eliminating PAM site for sgRNA target sequence 5'-ATTGGGGTCCAAGAATGGCA-3' and A -> C mutations at nt6022/6025/6040 for Glu1367/Glu1368/Glu1373 -> Ala mutations of CAD
  • Entrez Gene
    CAD (a.k.a. CDG1Z, DEE50, EIEE50, GATD4)
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTAGACGGCATCGCAGCTTGGATA
  • 3′ sequencing primer CGGAATTTACGTAGCGGCCGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXS-IRES-BLAST flag-CAD E1367A E1368A E1373A was a gift from Richard Possemato (Addgene plasmid # 188144 ; http://n2t.net/addgene:188144 ; RRID:Addgene_188144)

  • For your References section:

    Allosteric regulation of CAD modulates de novo pyrimidine synthesis during the cell cycle. Shin J, Mir H, Khurram MA, Fujihara KM, Dynlacht BD, Cardozo TJ, Possemato R. Nat Metab. 2023 Feb 6. doi: 10.1038/s42255-023-00735-9. 10.1038/s42255-023-00735-9 PubMed 36747088
Related items: