pGL4.23-Fosprom
(Plasmid
#188113)
-
PurposeExpresses luciferase under control of Fos promoter in transfected cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188113 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGL4.23
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4283
- Total vector size (bp) 5091
-
Modifications to backboneMinimal promoter removed and replaced with endogenous gene promoter.
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFos promoter
-
Alt namecFos
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)901
-
Entrez GeneFos (a.k.a. D12Rfj1, c-fos, cFos)
- Promoter Fos endogenous promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer ACTTATTTACAATCCTTCACTTGCT
- 3′ sequencing primer GGTCGAAGTTTGGGGAAAGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning by Virlana M Shchuka.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL4.23-Fosprom was a gift from Jennifer Mitchell (Addgene plasmid # 188113 ; http://n2t.net/addgene:188113 ; RRID:Addgene_188113) -
For your References section:
MYB and ELF3 differentially modulate labor-inducing gene expression in myometrial cells. Shchuka VM, Khader N, Dorogin A, Shynlova O, Mitchell JA. PLoS One. 2023 Jan 3;18(1):e0271081. doi: 10.1371/journal.pone.0271081. eCollection 2023. 10.1371/journal.pone.0271081 PubMed 36595497