pCAG-MBP-ATG9-Q835A
(Plasmid
#188081)
-
PurposeExpresses human ATG9-Q835A mutant in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188081 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameATG9
-
Alt nameMBP-TEVsite-ATG9-Q835A-stop
-
SpeciesH. sapiens (human)
-
MutationQ835A
-
Entrez GeneATG9A (a.k.a. APG9L1, MGD3208, mATG9)
- Promoter CMV
-
Tag
/ Fusion Protein
- MBP tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (unknown if destroyed)
- 3′ cloning site KpnI (unknown if destroyed)
- 5′ sequencing primer ccgctttctggtatgccgtgcg
- 3′ sequencing primer gagccagggcattggccacac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-MBP-ATG9-Q835A was a gift from James Hurley (Addgene plasmid # 188081 ; http://n2t.net/addgene:188081 ; RRID:Addgene_188081) -
For your References section:
Structural basis for ATG9A recruitment to the ULK1 complex in mitophagy initiation. Ren X, Nguyen TN, Lam WK, Buffalo CZ, Lazarou M, Yokom AL, Hurley JH. Sci Adv. 2023 Feb 15;9(7):eadg2997. doi: 10.1126/sciadv.adg2997. Epub 2023 Feb 15. 10.1126/sciadv.adg2997 PubMed 36791199