Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLKO.1 puro shRNA beta-catenin
(Plasmid #18803)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 18803 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1 puro
  • Backbone manufacturer
    Available at Addgene (#8453)
  • Backbone size w/o insert (bp) 7000
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    b-catenin shRNA
  • Alt name
    beta-catenin
  • Alt name
    CTNNB1
  • gRNA/shRNA sequence
    GCTTGGAATGAGACTGCTGAT
  • Species
    H. sapiens (human)
  • Entrez Gene
    CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

siRNA directed against beta-catenin: 5'-GCTTGGAATGAGACTGCTGAT-3'. Sequence from the website of the RNAi consortium at the Broad institute.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1 puro shRNA beta-catenin was a gift from Bob Weinberg (Addgene plasmid # 18803 ; http://n2t.net/addgene:18803 ; RRID:Addgene_18803)
  • For your References section:

    Loss of E-cadherin promotes metastasis via multiple downstream transcriptional pathways. Onder TT, Gupta PB, Mani SA, Yang J, Lander ES, Weinberg RA. Cancer Res. 2008 May 15. 68(10):3645-54. 10.1158/0008-5472.CAN-07-2938 PubMed 18483246