pLKO.1 puro shRNA beta-catenin
(Plasmid #18803)

• Purpose: 3rd gen lentiviral vector for knocking down beta-catenin gene expression
• Depositing Lab: Bob Weinberg
• Publication: Onder et al Cancer Res. 2008 May 15. 68(10):3645-54.

Backbone

• Vector backbone: pLKO.1 puro
• Backbone manufacturer: Available at Addgene (#8453)
• Backbone size w/o insert (bp): 7000
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: b-catenin shRNA
• Alt name: beta-catenin
• Alt name: CTNNB1
• gRNA/shRNA sequence: GCTTGGAATGAGACTGCTGAT
• Species: H. sapiens (human)
• Entrez Gene: CTNNB1 (a.k.a. CTNNB, EVR7, MRD19, NEDSDV, armadillo)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: LKO.1 5'

Resource Information

• Reference:
  • Addgene's pLKO.1 protocol
• Articles Citing this Plasmid:
  • 20 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

siRNA directed against beta-catenin: 5'-GCTTGGAATGAGACTGCTGAT-3'. Sequence from the website of the RNAi consortium at the Broad institute.