pLKO.1 puro shRNA E-cadherin
(Plasmid #18801)

• Depositing Lab: Bob Weinberg
• Publication: Onder et al Cancer Res. 2008 May 15. 68(10):3645-54.

Backbone

• Vector backbone: pLKO.1 puro
• Backbone manufacturer: Available at Addgene (#8453)
• Backbone size w/o insert (bp): 7000
• Vector type: Mammalian Expression, Lentiviral, RNAi
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: E-cadherin shRNA
• Alt name: E-Cadherin
• gRNA/shRNA sequence: AAGATAGGAGTTCTCTGATGC
• Species: H. sapiens (human)
• Entrez Gene: CDH1 (a.k.a. Arc-1, BCDS1, CD324, CDHE, ECAD, LCAM, UVO)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (destroyed during cloning)
• 3′ cloning site: EcoRI (unknown if destroyed)
• 5′ sequencing primer: LKO.1 5'

Resource Information

• Reference:
  • Addgene's pLKO.1 protocol
• Articles Citing this Plasmid:
  • 9 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

siRNA directed against E-cadherin: 5'-AAGATAGGAGTTCTCTGATGC-3'. Sequence from the website of the RNAi consortium at the Broad institute.

Please note that the sequence originally published in the paper was incorrect and the sequence above is the actual shRNA used.