GBH-R-cmlc2GFP.1
(Plasmid
#188004)
-
PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafish
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 188004 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKTol2-SE
-
Backbone manufacturerK.Clark
- Backbone size w/o insert (bp) 7200
-
Vector typeTargetable insertional mutagen and reporter system
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTargeted mRFP protein trap; secondary marker cmlc2 GFP
-
SpeciesD. rerio (zebrafish)
- Promoter Endogenuous Promoter; cmlc2 promotor
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuaI (unknown if destroyed)
- 3′ cloning site BspQI (unknown if destroyed)
- 5′ sequencing primer SEQ-pk-F1: TGTATTACTGTTTATGTAAGCAGACA
- 3′ sequencing primer SEQ-pk-R1: AGCGAGTCAGTGAGCGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is designed to have homology domains cloned into the 5' end and 3' end. Bfuai is used to clone in the 5' homology domain, while BspQi is used to clone in the 3' homology domain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GBH-R-cmlc2GFP.1 was a gift from Karl Clark (Addgene plasmid # 188004 ; http://n2t.net/addgene:188004 ; RRID:Addgene_188004)