Skip to main content
Addgene

pcDNA3.1-MUC2 D1D2D'D3 with cleavable His tag
(Plasmid #187994)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187994 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mucin2 D1D2D'D3
  • Alt name
    muc
  • Alt name
    MLP; SMUC; MUC-2
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_002457.4 NM_002457.4
  • Entrez Gene
    MUC2 (a.k.a. MLP, MUC-2, SMUC)
  • Promoter CMV
  • Tag / Fusion Protein
    • 6xHistadine followed by TEV cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-MUC2 D1D2D'D3 with cleavable His tag was a gift from Deborah Fass (Addgene plasmid # 187994 ; http://n2t.net/addgene:187994 ; RRID:Addgene_187994)

  • For your References section:

    Intestinal mucin is a chaperone of multivalent copper. Reznik N, Gallo AD, Rush KW, Javitt G, Fridmann-Sirkis Y, Ilani T, Nairner NA, Fishilevich S, Gokhman D, Chacon KN, Franz KJ, Fass D. Cell. 2022 Oct 27;185(22):4206-4215.e11. doi: 10.1016/j.cell.2022.09.021. Epub 2022 Oct 6. 10.1016/j.cell.2022.09.021 PubMed 36206754
Related items:
Commonly requested with: