pGB-05-06-GST-mCherry-ATG14
(Plasmid
#187988)
-
PurposePlasmid for the protein expression of GST-mCherry-ATG14 in a bacterial and insect expression system. Internal_Reference: SMC1322
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187988 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepGB-05-06
-
Backbone manufacturerProtech Facilities VBCF, Vienna, Austria
- Backbone size w/o insert (bp) 3619
- Total vector size (bp) 5821
-
Vector typeMammalian Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATG14
-
Alt nameBarkor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1479
-
GenBank ID22863 NM_014924
-
Entrez GeneATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
-
Tag
/ Fusion Protein
- GST-mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cggtccgaaaccatgtcccctatactaggttattggaaaat
- 3′ sequencing primer TTAATGGCGTTACCTATGTCCAGTGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGB-05-06-GST-mCherry-ATG14 was a gift from Sascha Martens (Addgene plasmid # 187988 ; http://n2t.net/addgene:187988 ; RRID:Addgene_187988)