Skip to main content
Addgene

mCherry-p62-Silent_Mutation_WT
(Plasmid #187986)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187986 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmCherry-C1 Vector
  • Backbone manufacturer
    Clontech #632524
  • Backbone size w/o insert (bp) 4722
  • Total vector size (bp) 6013
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    p62
  • Species
    H. sapiens (human)
  • Mutation
    silent mutation for resistance to sip62 #5
  • GenBank ID
    23636 NM_153719
  • Entrez Gene
    NUP62 (a.k.a. IBSN, SNDI, p62)
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGGTGAGCAAGGGCGAGGAGGATA
  • 3′ sequencing primer gggTCACAACGGCGGGGGATGCTTTGAATA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCherry-p62-Silent_Mutation_WT was a gift from Sascha Martens (Addgene plasmid # 187986 ; http://n2t.net/addgene:187986 ; RRID:Addgene_187986)
  • For your References section:

    Oligomerization of p62 allows for selection of ubiquitinated cargo and isolation membrane during selective autophagy. Wurzer B, Zaffagnini G, Fracchiolla D, Turco E, Abert C, Romanov J, Martens S. Elife. 2015 Sep 28;4:e08941. doi: 10.7554/eLife.08941. 10.7554/eLife.08941 PubMed 26413874