mcherry-p62 Double Mutation/Silent
(Plasmid
#187982)
-
PurposeK7A/D69A p62 double mutant (PB1AA). Internal reference: SMC532
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmCherry-C1 Vector
-
Backbone manufacturerClontech #632524
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 5707
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep62
-
SpeciesH. sapiens (human)
-
MutationD7A, D69A, silent mutation
-
GenBank ID23636 NM_153719
-
Entrez GeneNUP62 (a.k.a. IBSN, SNDI, p62)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAATGGCGTCGCTCACCGTGGCTGCCT
- 3′ sequencing primer TCACAACGGCGGGGGATGCTTTGAATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mcherry-p62 Double Mutation/Silent was a gift from Sascha Martens (Addgene plasmid # 187982 ; http://n2t.net/addgene:187982 ; RRID:Addgene_187982) -
For your References section:
Oligomerization of p62 allows for selection of ubiquitinated cargo and isolation membrane during selective autophagy. Wurzer B, Zaffagnini G, Fracchiolla D, Turco E, Abert C, Romanov J, Martens S. Elife. 2015 Sep 28;4:e08941. doi: 10.7554/eLife.08941. 10.7554/eLife.08941 PubMed 26413874