pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
(Plasmid #187959)

• Purpose: Expressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.
• Depositing Lab: Edda Schulz
• Publication: Noviello et al Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4.

Backbone

• Vector backbone: pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9
• Backbone size w/o insert (bp): 13866
• Total vector size (bp): 14235
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Blasticidin resistance

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: PmeI (not destroyed)
• 5′ sequencing primer: GCCAAGCCTTTGTCTCAAG

Gene/Insert 2

• Gene/Insert name: FKBP12_F36V
• Alt name: FKBP12 (F36V mutant)
• Species: H. sapiens (human), Synthetic
• Tag / Fusion Protein:
  • GGS linker (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGCGGATCTGGAGGTAGTG
• 3′ sequencing primer: CTATTCCAGTTTTAGAAGCTCCACA

Resource Information

• Supplemental Documents:
  • pSLQ2818_Blasti_pPB CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V.gb
• A portion of this plasmid was derived from a plasmid made by: The FKBP12_F36V domain is fused C-terminally to dCas9, using as a backbone the plasmid pSLQ2818 (pPB: CAG-PYL1-KRAB-IRES-Puro-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9, Addgene 84,241; a gift from Stanley Qi), after exchanging the Puromycin resistance with a resistance for Blasticidin.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511019v1 for bioRxiv preprint.