pSLPB2B-FKBP12_F36V-KRAB-SpdCas9-tagBFP-PGK-Blasticidin
(Plasmid #187957)

• Purpose: FKBP12 (F36V mutant) degron-tagged KRAB-dCas9 fused with tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.
• Depositing Lab: Edda Schulz
• Publication: Noviello et al Nat Commun. 2023 Jun 3;14(1):3225. doi: 10.1038/s41467-023-38909-4.

Backbone

• Vector backbone: pSLPB2-FKBP_F36V-SpdCas9-tagBFP-PGK-Blasticidin
• Backbone size w/o insert (bp): 11406
• Total vector size (bp): 11230
• Vector type: Mammalian Expression, CRISPR, Synthetic Biology
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FKBP12_F36V-KRAB-SpdCas9-tagBFP
• Alt name: S. pyogenes Cas9 (D10A; N863A)
• Alt name: FKBP12 (F36V mutant)
• Alt name: KRAB domain
• Species: H. sapiens (human), Synthetic; S. pyogenes
• Tag / Fusion Protein:
  • GGS (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAGGAGGTGGAAGCGGA
• 3′ sequencing primer: GGGCTCTTCTCCCTTCTCCA

Resource Information

• Supplemental Documents:
  • pSLP2B-NLS-dTAG-linker-KRAB-linker-dCas9-tagBFP-pGK-Blasticidin Bv2 Copy.gb
• A portion of this plasmid was derived from a plasmid made by: The KRAB domain was amplified from pHR-SFFV-KRAB-dCas9-P2A-mCherry from Jonathan Weissman lab (Addgene plasmid # 60954 ; http://n2t.net/addgene:60954 ; RRID:Addgene_60954)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2022.10.05.511019v1 for bioRxiv preprint.